Microscopy:Article Title: An iPSC-derived small intestine-on-chip with self-organizing epithelial, mesenchymal, and neural cells.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit IgG anti-VIM Dilution 1:100, microscopy Cell Signaling Technology Cat#5741S; RRID: AB_10695459 Mouse IgG1 anti-EPCAM/CD326 Dilution 1:500, microscopy Cell Signaling Technology Cat#2929S; RRID: AB_2098657 Mouse IgG1 anti-CHGA Dilution 1:100, microscopy Thermo Fisher Cat#MA5-13096; RRID: AB_10987033 Mouse IgG1 anti-MUC2 Dilution 1:200, microscopy Abcam Cat#ab118964; RRID: AB_10903815 Mouse IgG2a anti-LYZ Dilution 1:200, microscopy Novus Biologicals Cat#NB100-63062; RRID: AB_964363 Rabbit IgG anti-MKI67 Dilution 1:200, microscopy Abcam Cat#ab16667; RRID: AB_302459 Rabbit polyclonal anti-RBP2 Dilution 1:100, microscopy Sigma Aldrich Cat#HPA035866; RRID: AB_10672232 Mouse IgG1 anti-ZO-1 Dilution 1:100, microscopy Thermo Fisher Cat#33-9100; RRID: AB_2533147 Goat IgG polyclonal anti-CDX2 Dilution 1:100, microscopy R&D systems Cat#AF3665-SP; RRID: AB_2077020 Alexa Fluor 488 donkey anti-Mouse IgG Dilution 1:250, microscopy Jackson ImmunoResearch Cat#715-545-150; RRID: AB_2340846 Alexa Fluor 647 donkey anti-Goat IgG Dilution 1:250, microscopy Thermo Fisher Cat#A-21447; RRID: AB_2535864 Cy3 donkey anti-Rabbit IgG Dilution 1:250, microscopy Jackson ImmunoResearch Cat#711-165-152; RRID: AB_2307443 Alexa Fluor 594 conjugate anti-VIM Dilution 1:50, flow cytometry Cell Signaling Technology Cat#7675S; RRID: AB_2797632 BUV737 conjugate anti-EPCAM/CD326 Dilution 1:100, flow cytometry BD Biosciences Cat#748397; RRID: AB_2872816 PE conjugate anti-CHGA Dilution 1:1000, flow cytometry Abcam Cat#ab213341 PerCP conjugate anti-MUC2 Dilution 1:70, flow cytometry Novus Biologicals Cat#NBP2-34757PCP Alexa Fluor 488 conjugate anti-LYZ Dilution 1:200, flow cytometry Novus Biologicals Cat#NB100-63062AF488 Experimental models: Cell lines Human induced pluripotent stem cell lines iPSC/CRISPR facility, University Medical Center Groningen N/A Deposited data Raw and processed single-cell RNA sequencing data This paper https://github.com/umcg-immunogenetics/ Intestine_on_Chip_Moerkens_2024 Oligonucleotides Primer: GAPDH Forward: ATGGGGAAGGTGAAGGTCG Reverse: GGGGTCATTGATGGCAACAATA Widely used N/A Primer: GBP1 Forward: AAACTTCAGGAACAGGAGCAAC Reverse: GGTACATGCCTTTCGTCGTCT Workman et al.17 N/A (Continued on next page) 18 Cell Reports 43, 114247, July 23, 2024 ..
Flow Cytometry:Article Title: An iPSC-derived small intestine-on-chip with self-organizing epithelial, mesenchymal, and neural cells.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit IgG anti-VIM Dilution 1:100, microscopy Cell Signaling Technology Cat#5741S; RRID: AB_10695459 Mouse IgG1 anti-EPCAM/CD326 Dilution 1:500, microscopy Cell Signaling Technology Cat#2929S; RRID: AB_2098657 Mouse IgG1 anti-CHGA Dilution 1:100, microscopy Thermo Fisher Cat#MA5-13096; RRID: AB_10987033 Mouse IgG1 anti-MUC2 Dilution 1:200, microscopy Abcam Cat#ab118964; RRID: AB_10903815 Mouse IgG2a anti-LYZ Dilution 1:200, microscopy Novus Biologicals Cat#NB100-63062; RRID: AB_964363 Rabbit IgG anti-MKI67 Dilution 1:200, microscopy Abcam Cat#ab16667; RRID: AB_302459 Rabbit polyclonal anti-RBP2 Dilution 1:100, microscopy Sigma Aldrich Cat#HPA035866; RRID: AB_10672232 Mouse IgG1 anti-ZO-1 Dilution 1:100, microscopy Thermo Fisher Cat#33-9100; RRID: AB_2533147 Goat IgG polyclonal anti-CDX2 Dilution 1:100, microscopy R&D systems Cat#AF3665-SP; RRID: AB_2077020 Alexa Fluor 488 donkey anti-Mouse IgG Dilution 1:250, microscopy Jackson ImmunoResearch Cat#715-545-150; RRID: AB_2340846 Alexa Fluor 647 donkey anti-Goat IgG Dilution 1:250, microscopy Thermo Fisher Cat#A-21447; RRID: AB_2535864 Cy3 donkey anti-Rabbit IgG Dilution 1:250, microscopy Jackson ImmunoResearch Cat#711-165-152; RRID: AB_2307443 Alexa Fluor 594 conjugate anti-VIM Dilution 1:50, flow cytometry Cell Signaling Technology Cat#7675S; RRID: AB_2797632 BUV737 conjugate anti-EPCAM/CD326 Dilution 1:100, flow cytometry BD Biosciences Cat#748397; RRID: AB_2872816 PE conjugate anti-CHGA Dilution 1:1000, flow cytometry Abcam Cat#ab213341 PerCP conjugate anti-MUC2 Dilution 1:70, flow cytometry Novus Biologicals Cat#NBP2-34757PCP Alexa Fluor 488 conjugate anti-LYZ Dilution 1:200, flow cytometry Novus Biologicals Cat#NB100-63062AF488 Experimental models: Cell lines Human induced pluripotent stem cell lines iPSC/CRISPR facility, University Medical Center Groningen N/A Deposited data Raw and processed single-cell RNA sequencing data This paper https://github.com/umcg-immunogenetics/ Intestine_on_Chip_Moerkens_2024 Oligonucleotides Primer: GAPDH Forward: ATGGGGAAGGTGAAGGTCG Reverse: GGGGTCATTGATGGCAACAATA Widely used N/A Primer: GBP1 Forward: AAACTTCAGGAACAGGAGCAAC Reverse: GGTACATGCCTTTCGTCGTCT Workman et al.17 N/A (Continued on next page) 18 Cell Reports 43, 114247, July 23, 2024 ..
Single Cell:Article Title: An iPSC-derived small intestine-on-chip with self-organizing epithelial, mesenchymal, and neural cells.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit IgG anti-VIM Dilution 1:100, microscopy Cell Signaling Technology Cat#5741S; RRID: AB_10695459 Mouse IgG1 anti-EPCAM/CD326 Dilution 1:500, microscopy Cell Signaling Technology Cat#2929S; RRID: AB_2098657 Mouse IgG1 anti-CHGA Dilution 1:100, microscopy Thermo Fisher Cat#MA5-13096; RRID: AB_10987033 Mouse IgG1 anti-MUC2 Dilution 1:200, microscopy Abcam Cat#ab118964; RRID: AB_10903815 Mouse IgG2a anti-LYZ Dilution 1:200, microscopy Novus Biologicals Cat#NB100-63062; RRID: AB_964363 Rabbit IgG anti-MKI67 Dilution 1:200, microscopy Abcam Cat#ab16667; RRID: AB_302459 Rabbit polyclonal anti-RBP2 Dilution 1:100, microscopy Sigma Aldrich Cat#HPA035866; RRID: AB_10672232 Mouse IgG1 anti-ZO-1 Dilution 1:100, microscopy Thermo Fisher Cat#33-9100; RRID: AB_2533147 Goat IgG polyclonal anti-CDX2 Dilution 1:100, microscopy R&D systems Cat#AF3665-SP; RRID: AB_2077020 Alexa Fluor 488 donkey anti-Mouse IgG Dilution 1:250, microscopy Jackson ImmunoResearch Cat#715-545-150; RRID: AB_2340846 Alexa Fluor 647 donkey anti-Goat IgG Dilution 1:250, microscopy Thermo Fisher Cat#A-21447; RRID: AB_2535864 Cy3 donkey anti-Rabbit IgG Dilution 1:250, microscopy Jackson ImmunoResearch Cat#711-165-152; RRID: AB_2307443 Alexa Fluor 594 conjugate anti-VIM Dilution 1:50, flow cytometry Cell Signaling Technology Cat#7675S; RRID: AB_2797632 BUV737 conjugate anti-EPCAM/CD326 Dilution 1:100, flow cytometry BD Biosciences Cat#748397; RRID: AB_2872816 PE conjugate anti-CHGA Dilution 1:1000, flow cytometry Abcam Cat#ab213341 PerCP conjugate anti-MUC2 Dilution 1:70, flow cytometry Novus Biologicals Cat#NBP2-34757PCP Alexa Fluor 488 conjugate anti-LYZ Dilution 1:200, flow cytometry Novus Biologicals Cat#NB100-63062AF488 Experimental models: Cell lines Human induced pluripotent stem cell lines iPSC/CRISPR facility, University Medical Center Groningen N/A Deposited data Raw and processed single-cell RNA sequencing data This paper https://github.com/umcg-immunogenetics/ Intestine_on_Chip_Moerkens_2024 Oligonucleotides Primer: GAPDH Forward: ATGGGGAAGGTGAAGGTCG Reverse: GGGGTCATTGATGGCAACAATA Widely used N/A Primer: GBP1 Forward: AAACTTCAGGAACAGGAGCAAC Reverse: GGTACATGCCTTTCGTCGTCT Workman et al.17 N/A (Continued on next page) 18 Cell Reports 43, 114247, July 23, 2024 ..
RNA Sequencing:Article Title: An iPSC-derived small intestine-on-chip with self-organizing epithelial, mesenchymal, and neural cells.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit IgG anti-VIM Dilution 1:100, microscopy Cell Signaling Technology Cat#5741S; RRID: AB_10695459 Mouse IgG1 anti-EPCAM/CD326 Dilution 1:500, microscopy Cell Signaling Technology Cat#2929S; RRID: AB_2098657 Mouse IgG1 anti-CHGA Dilution 1:100, microscopy Thermo Fisher Cat#MA5-13096; RRID: AB_10987033 Mouse IgG1 anti-MUC2 Dilution 1:200, microscopy Abcam Cat#ab118964; RRID: AB_10903815 Mouse IgG2a anti-LYZ Dilution 1:200, microscopy Novus Biologicals Cat#NB100-63062; RRID: AB_964363 Rabbit IgG anti-MKI67 Dilution 1:200, microscopy Abcam Cat#ab16667; RRID: AB_302459 Rabbit polyclonal anti-RBP2 Dilution 1:100, microscopy Sigma Aldrich Cat#HPA035866; RRID: AB_10672232 Mouse IgG1 anti-ZO-1 Dilution 1:100, microscopy Thermo Fisher Cat#33-9100; RRID: AB_2533147 Goat IgG polyclonal anti-CDX2 Dilution 1:100, microscopy R&D systems Cat#AF3665-SP; RRID: AB_2077020 Alexa Fluor 488 donkey anti-Mouse IgG Dilution 1:250, microscopy Jackson ImmunoResearch Cat#715-545-150; RRID: AB_2340846 Alexa Fluor 647 donkey anti-Goat IgG Dilution 1:250, microscopy Thermo Fisher Cat#A-21447; RRID: AB_2535864 Cy3 donkey anti-Rabbit IgG Dilution 1:250, microscopy Jackson ImmunoResearch Cat#711-165-152; RRID: AB_2307443 Alexa Fluor 594 conjugate anti-VIM Dilution 1:50, flow cytometry Cell Signaling Technology Cat#7675S; RRID: AB_2797632 BUV737 conjugate anti-EPCAM/CD326 Dilution 1:100, flow cytometry BD Biosciences Cat#748397; RRID: AB_2872816 PE conjugate anti-CHGA Dilution 1:1000, flow cytometry Abcam Cat#ab213341 PerCP conjugate anti-MUC2 Dilution 1:70, flow cytometry Novus Biologicals Cat#NBP2-34757PCP Alexa Fluor 488 conjugate anti-LYZ Dilution 1:200, flow cytometry Novus Biologicals Cat#NB100-63062AF488 Experimental models: Cell lines Human induced pluripotent stem cell lines iPSC/CRISPR facility, University Medical Center Groningen N/A Deposited data Raw and processed single-cell RNA sequencing data This paper https://github.com/umcg-immunogenetics/ Intestine_on_Chip_Moerkens_2024 Oligonucleotides Primer: GAPDH Forward: ATGGGGAAGGTGAAGGTCG Reverse: GGGGTCATTGATGGCAACAATA Widely used N/A Primer: GBP1 Forward: AAACTTCAGGAACAGGAGCAAC Reverse: GGTACATGCCTTTCGTCGTCT Workman et al.17 N/A (Continued on next page) 18 Cell Reports 43, 114247, July 23, 2024 ..
|